(Molecular) bio – informatics: bioinformatics is conceptualising biology in terms of molecules (in the sense of physical chemistry) and applying "informatics techniques" (derived from disciplines such as applied maths, computer science and statistics) to understand and organise the information associated with these molecules, on a large scale. In short, bioinformatics is a management information system for molecular biology and has many practical applications.
Broadly speaking, Bioiformatics or computational biology is the application of computer science, statistics, and mathematics to problems in biology. Computational biology spans a wide range of fields within biology, including genomics/genetics, biophysics, cell biology, biochemistry, and evolution. Likewise, it makes use of tools and techniques from many different quantitative fields, including algorithm design, machine learning, Bayesian and frequentist statistics, and statistical physics.
What kinds of problems do computational biologists work on?
Much of computational biology is concerned with the analysis of molecular data, such as biosequences (DNA, RNA, or protein sequences), three-dimensional protein structures, gene expression data, or molecular biological networks (metabolic pathways, protein-protein interaction networks, or gene regulatory networks). A wide variety of problems can be addressed using these data, such as the identification of disease-causing genes, the reconstruction of the evolutionary histories of species, and the unlocking of the complex regulatory codes that turn genes on and off. Computational biology can also be concerned with non-molecular data, such as clinical or ecological data.
What are the differences between computational biology and bioinformatics?
The terms computational biology and bioinformatics are often used interchangeably. However, computational biology sometimes connotes the development of algorithms, mathematical models, and methods for statistical inference, while bioinformatics is more associated with the development of software tools, databases, and visualization methods.
For your Classwork No. 1
GACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGCCCTATTGAGACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAGATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAGCTGAGACAACATCTGTTGAGGTGGGGACTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGA
1. What is the name of the protein that contain this DNA sequence?
2. In which organism does was this sequence derived from?
3. When was the sequence loaded in the database?
4. What is the Accession number of the sequence?
5. What is the percentage identity of the sequence to the query seuence?
6. What is the Expectation(E)-value of the results?
1. What is the name of the protein that contain this DNA sequence?
2. In which organism does was this sequence derived from?
3. When was the sequence loaded in the database?
4. What is the Accession number of the sequence?
5. What is the percentage identity of the sequence to the query seuence?
6. What is the Expectation(E)-value of the results?
No comments:
Post a Comment